23.6.09

Cero química

Este fin de semana vi Nunca es tarde para enamorarse, con Dustin Hoffman y Emma Thomson. Más que una pareja lista para el amor tardío, parecían un par de hermanos en pantuflas.

Pocas cosas me decepcionan tanto como ver una película con mi actor preferido (no es el caso de Hoffman) y que la doña no le haga honor.
Señores productores: no se gasten con el género romántico si entre él y ella hay cero química.

Listado de parejas potentes:

Clark Gable y Vivien Leigh en Lo que le viento...

Humphrey Bogart e Ingrid Bergman en Casablanca
Jack Nicholson y Jessica Lange en El Cartero...
Tony Leung y Maggie Cheung en Con ánimo de amar
Sam Sheppard con alguien que no sea Diane Keaton
John Cusack con su novia en Alta Fidelidad
Kevin Kleine con Meg Ryan antes de que se convirtiera en otra
Andy García con Meg Ryan antes de que se convirtiera en otra
Billy Krystal y Debra Winger en Olvídate de Paris
Antonio Banderas y Victoria Abril
Mark Ruffalo y Naomi Watts en Adulterio
Ethan Hauke con cualquiera
George Clooney con ¡stella!

De las nuestras... ahí van:

Juan Palomino y Paola Krum en Río Escondido
Ricardo Darín y Cecilia Roth en Katmchatka
José y Sofía, en Tratame bien

Y no se me ocurren más, ¿puede ser?



163 comentarios:

Angie Angelina dijo...

ay no me gusta ser maestra ciruelka pero no es jack sino john cusack y mark no es buffallo (aunque perece un buffallo) sino ruffallo. Y el esta muy bien con reese whiterspoon en una que ella era un fantasma de una medica, mas o menos asi.
Coincido, ethan hawke con cualquiera.

Angie Angelina dijo...

ah, nacionales, la pareja del Lado oscuro del corazón está muy bien.

Wonder dijo...

- Hearvey Keitel y Holly Hunter en The Piano
- Steve McQueen y Faye Dunaway en The Thomas Crown Affair
- Glen Ford y Rita Haywood en Gilda
- Dirk Bogarde y Charlotte Rampling en The Night Porter
- Vigo Mortensen y Naomi Watts en Eastern Promises
- Vigo Mortensen y Maria Bello en A History Of Violence
- Jorge Román y Mimí Ardú y El Bonaerense

Luego sigo.

AM dijo...

Steve McQueen y Jacqueline Bisset en Bullit.
Gene Tierney y Dana Andrews en Laura (Laura, anotá)
Humphrey Bogart y Lauren Bacall en Key Largo
Ralph Fiennes y Kristin Scott Thomas en The English Patient
Jeremy Irons y Dominique Swain en Lolita (la de Adrian Lyne, no la pedorra de Kubrick)
Arnaldo André y Luisa Kuliok en donde haya sido.
Raul Julia y William Hurt en El Beso de la Mujer Araña.

Laura dijo...

AM, Ud sabe que mi padre me puso Laura por ese film, ¿no?
Me encantan las casualidades.

AM dijo...

No diga. Conoce el tema de la película. Es muy lindo. Especialmente cuando lo toca Charlie Parker. A mi, en cambio, me pusieron Gilda por que mi madre era una fanática de Rita H.

Estrella dijo...

ANGELINA,
Gracias!

WONDER,
Buen listado!
Están saliendo algunas parejas en las que pensé y no puse, por ejemplo:

Jorge Román y Mimí Ardú y El Bonaerense: qué pareja explosiva, sexo del de verdad.

AM,
También iba a poner:

Ralph Fiennes y Kristin Scott Thomas en The English Patient

Porque ella me parece una mujer sumamente sexual, a pesar de no ser la más linda entre las lindas.

Gracias, AM!
Arnaldo y Luisa: ¡!

AM dijo...

Clint Eastwood y Mery Streep en Los Puentes de Madison
Lee Marvin y Gloria Grahame en The big heat
El gordo Porcel y Luisa Albinoni en A los cirujanos se les va la mano
Jorge Barreiro y Gogo Rojo en Hay que romper la rutina
Robert Redford y Meryl Streep en Out of Africa

Laura dijo...

AM, ah, bueno, menos mal que su madre no era una fanática de Marie Curie, si no le hubiesen puesto Polonio

AM dijo...

Polonio es mi segundo nombre porque mi viejo era fan de Pepe Iglesias. Sho soy Gilda Polonio.

Laura dijo...

El chocolate estaba muy caliente, de tan caliente, la lengua me quemé. ¿Saben por quén saben por qué, por qué la lengua me quemé?
Por que el chocolate...

Juli dijo...

Parejas con química? Nombraría a Clint Eastwood y Meryl Streep, pero ya lo dijo AM
Ethan Hawke con Julie Delpy
Meryl Streep con Jack Nicholson (Heartburn)
Jack Nicholson y Shirley MacLaine
George Clooney y Michelle Pfeiffer (perdón Stella ;) O ella con Al Pacino
Julia Ormond con Brad Pitt

Me gusta esto! ;)

Yoni Bigud dijo...

Sofía y Topa, los presentadores del canal Disney.

Ah... ¿cómo? ¿no vale?

Un saludo.

Wonder dijo...

- Nicolas Cage y Laura Dern en Corazón Salvaje
- Peter Finch y Audrey Hepburn en Historia de una Monja
- Batman y Gatúbela
- Mary Poppins y Jupi
- Estrella y Anónimo malo.

Mensajero dijo...

Juliete Binoche y Denis Lavant
Mastroianni y anita Ekberg
Jane BIrkin y Serge Gainsbourg
Marlon Brando y Maria Schneider
Monzón y Susana Gimenez

Falluto dijo...

Esa chica Laura es media rara, ¿no? ¡Qué cosas dice!

Angie Angelina dijo...

Ayer pasaron Moonstruck:
Inolvidables Cher y Nicholas Cage, cuánta pasión.

Angie Angelina dijo...

Quién es la stella de george clooney???

Angie Angelina dijo...

- richard gere y julia roberts
- Jonhhy deep con cualquiera

Wonder dijo...

Angie!!! Stella!!!! Una amiga de la casa.
Y Johnny es Depp... porfi, que no me gusta ni un poco cuando la gente dice "Dip"

Angie Angelina dijo...

Stella de Un tranvia llamado deseo, no entiendo, ese no era brando?

Falluto dijo...

Lo que pasa señora Wonder es que usted sabe de galanes de cine más que nadie y se hace la pispireta con nosotros que somos legos de lejos.

MQDLV dijo...

yo ayuer vi Mikl y creo que me quedo con Sean y el muchacho que lo acompaña. Y perdonen la baba: pero todo sea por ese muchacho que acomapaña!
Besos por acà!

Wonder dijo...

No Angie. Mirá.
Esta es Stella, una amiga

Falluto, no me haga enojar. Sólo soy una aprendiz, una pequeña saltamontes.

Juli dijo...

Audrey Hepburn y George Peppard

Falluto dijo...

Señora W. ¿Acaso no es usted mejor cuando se enoja? ¿O se hace la viva y después huye despavorida?

sobredosisdescasez dijo...

Brutus (habrá alguno con tanto empeño) y Olivia (habrá alguna tan "voluble")

Juli dijo...

Tom Hanks y Meg Ryan ya lo dijeron?

Wonder dijo...

Falluto, yo no me puedo hacer la viva con nadie.
Soy toda una tarada. Recuérdelo.

Estrella dijo...

AM, me hiciste reír... ¡Luisa Albinoni!

El gordo Porcel y Luisa Albinoni en A los cirujanos se les va la mano
Jorge Barreiro y Gogo Rojo en Hay que romper la rutina

MQDLV,
Yo también lo fiché al amigo de Milk!

SOBREDOSIS,
Olivia y Brutus: había algo decididamente sexual en esa pareja!

Bien por las cinco de MENSAJERO...

Sigo en un rato

¿Más argentinas?

¿Vieronn ue no hay?

¿Será porque no hay química entre los argentinos y las argentinas?

WONDER, al anónimo le faltan cumplir muchos años, soy vieja para él. Te lo regalo.

Anita dijo...

Thandie Newton y David Thewlis en Cautivos del amor (Besieged).
James Spader y Deborah Kara Unger en Crash (la de Cronenberg, no la bosta que ganó el Oscar).
Las dos parejas del paciente inglés.
Y reíte, pero me encantó la pareja de Marlon Brando y Anna Magnani en The fugitive kind!!

Mary Poppins dijo...

Kathleen Turner y William Hurt en Body Heat

Sahron Stone y Douglas en Basic Instint I

Pacino y Ellen Barkin en Sea of Love

Marlon Brando y Maria Scheinder en el ultimo tango en paris

Susu Pecoraro e Imanol Arias en Camila

pero como la primera ummmm

ah! olvidaba cocorastuti y la condesa sangrienta

lucia dijo...

Naomi Watts y Sean Penn en 21 gramos. Desesperante

Anónimo dijo...

Daniel Day Lewis & Michelle Pfeiffer
Katherine Hepburn & Spencer Tracy
China Zorrila & Dany Kaye
Simone Signoret & Jean Gabin
Imanol Arias & Susu Pecoraro
Anouk Aimée & Jean-Louis Trintignant

sobredosisdescasez dijo...

Estrella
Grandes químicas argentinas (de las que fuí testigo y a veces te ponías colorado)
Camila Perisse y el Cholo Pavón
Gra Borges y "anguila" Gutierrez
Silvia Peirú y Walter Fernandez
Yo y....., disculpen pero aún no.

Estrella dijo...

¿Y Marisa Tomei? ¿Con quién?

SOBREDOSIS, dale!

Wonder dijo...

Marisa Tomei con Mickey Rourke, obvio.

Wonder dijo...

O con Robert Downey Jr.
Lo que pasa es que Robert les queda bien a todas, pero especialmente me quedaría divino a mi.
Lo juro.

Mickey dijo...

Discrepo con eso de Fulanito y cualquiera.

Se necesitan dos para el tango. Por ejemplo, Penelope Cruz, además de ser pésima actriz, no levanta con nadie al lado. Idem Tom Cruise, al que ni siquiera Kelly McGillis (en su mejor momento) lo uso en onda.

marmottan dijo...

Gina Lollobrigida y Rock Hudson en Tuya en Septiembre.
Robert de Niro y meryl Streep en Enamorandose

Mensajero dijo...

Sam Shepard y Kim Bassinger

Mensajero dijo...

King kong y Jessica Lange

Angie Angelina dijo...

Ah, Wonder! ¿Es la que habla con muchos "!!!!!!!!!" ?

Angie Angelina dijo...

argentina debe haber alguna de leo sbaraglia donde esté bien, caballos salvajes? no, plata quemada? no
COMO se olvidaron de dopazo- miras en Tango feroz, che...

Anónimo dijo...

o quimica tiene todos ustedes, q paso q desaparecieron muchos despues de la reunion? .. jaja, se vieron y se asustaron

Pedro dijo...

-Ingrid Bergman-Cary Grant en Notorious
-Marisa Tomei-Joe Pesci en My cousin Vinny

Anónimo dijo...

cambiaron de nick.. q truchos

Mary Poppins dijo...

Nicolas Cage and Elizabeth Shue en Leaving Las Vegas

Mary Poppins dijo...

Mickey Rourke and Kim Bassinger 9 semanas y media

Angie Angelina dijo...

audrey hepburn creo que en cualquiera pero el otro diua vi una pelicula preciosa que se llama Love in the afternoon, con gary cooper, ya grande.
Ardia el set, y no se sacaban la ropa, ella como maximo, perdia un zapato.

dr 7 dijo...

Como dos hermanos en pantuflas, Eso sí que estuvo bueno. Hay muchos. Pienso y vuelvo.

Angie Angelina dijo...

lo que yo estoy pensando es que los ejs de nacionales que pusiste Estre, son casi todas parejas casadas, no como los de las peliculas estadounidenses.

me gustaron
mel gibson- helen hunt en Lo que ellas quieren

Mensajero dijo...

último>
Anthony Quinn y Giuletta Massina

Koba dijo...

Me ganó de mano Mary Poppins:
Kathleen Turner y William Hurt en Body Heat (Cuerpos Ardientes)

Entonces elijo otra (¿ya la dijeron?):
Jane Greer y Robert Mitchum en Out of the Past (Retorno al Pasado)

Y hablando un poco del post, es difícil encontrarle una pareja tanto a la Thompson como a Hoffman no?

AM dijo...

Sin sexo

Doris Day y James Stewart
Rod Taylor y Tippi Hedren
Sean Connery y Tippi Hedren
James Stewart y Kim Novak
Boris Karloff y Elsa Lanchester
Paul Newman y Julie Andrews
Anthony Perkins y Vera Miles
James Stewart y Grace Kelly
Barry Foster y Anna Masey
Beba Bidart y Antuco Telesca

La candorosa dijo...

George Clooney y Stella, ganan lejos!!

Abrazos!!

La condesa sangrienta dijo...

Audrey Hepburn y Gregory Peck (La princesa que quería vivir).

Susana Giménez y Monzón (aunque ya lo dijeron, porque la química trascendió la pantalla).

Guatemalan Genes dijo...

De acuerdo con Juli en
Ethan Hawke con Julie Delpy en Before Sunrise pero aun mas en Before Sunset... ya con una quimica madura uffff por supuesto tambien es el script que te hace recordar esos momentos que todos hemos vivido en los que estas pretendiendo que no pasa nada pero cada roce 'casual' te quema.

Casi me daban ganas de mandar a la punta a mi esposo para que luego pudieramos reencontranos y tener ese exhiliration. :)

lucia dijo...

before sunset! totalmente

y julie andrews con el capitan FONTRAP!!! sentaditos en el banco....

Stella dijo...

Ehhh, la Stella del Cluny soy yo, solo que ando media perdida!
Gracias por no olvidarnos, Estre!
ajajaja :)

De las que dijeron,y conozco, la pareja de Hearvey Keitel y Holly Hunter en The Piano, me parece una de las mejores!!
Y no se si ya la dijeron y se me pasó, pero Susu Pecoraro e Imanol Arias en Camila, hacen arder la pantalla!

Besooossss

Stella dijo...

Mónica y Rolando!!!
Mi mamá no me dejaba verlos porque decía que eran muy hot! Y hablo de la época de los 70!

Te quieero como sos, asi tal cual, tal cual estás, sin pretender cambiarte nada porque asi me hacés feliiiiiizz

Mary Poppins dijo...

ésta es mi favorita que les parece?

Enterhase dijo...

Al Pacino y Diane Keaton
Ethan Hawke y Gwyneth Paltrow
Meg Ryan y Tom Hanks
Ryan Gosling y Rachel McAdams
Ewan McGregor y Nicole Kidman
Kate Winslet y Leonardo Di Caprio
Kate Winslet y David Kross

Enterhase dijo...

Ah, y Woody Harrelson con Demi Moore en Propuesta indecente!

Juli dijo...

Ed Harris y Madeleine Stowe en China moon
Aunque, como diría Wonder, Ed Harris haría una pareja diviiiina conmigo. Bueno, el Ed Harris de hace unos años al menos ;)

Estrella dijo...

ANTIA,
La pareja de Crash, de Cronemberg, sí. Y las del Paciente Inglés ya la nombraron varios: ahí hay algo! También me gusta William Hurt, MARY, pero no M. Douglas... para mí se pasa de vueltas. Naomi Watts, LUCIA, es tan sexy que no le cuesta encontrar pareja, que raro que nadie nombró a una ... esperemos.
ANÓNIMO que debe de ser mi hermana, bien por tu lista. SOBREDOSIS, Camila Perisé! ja!, ¿qué se habrá hecho de esa mujer?
WONDER, Marisa Tomei en aquella película en la que se estaba por casar pero algo le hizo ruido y se fue a Italia y ahí lo conoce a nuestro Robert D. Otro que le queda bien a todoas, especialmente a la mujer maravilla, aunque no lo jure. Parece que a MICKEY no le va eso de Fulanito con cualquiera. Pasa que algunos, sólo algunos, tienen ese no sé qué, y coincido con Penélope Cruz, pero con con Tom Cruise, me gustaba con la del diario de B. Jones. MARMOTTAN se acordó de Enamorándose, y sí, había química entre ellos dos arriba del tren. Y MENSAJERO trae a Kim Bassinger, una de las mujeres más lindas, ¿cómo no va a ser explosión junto a Sam Sheppard? Pero con la lindura sola no hacemos nada, miren si no a King Kong! ANGELINA y Leonardo Sbaraglia: no para mí, le falta algo, me quedo con Juan Palomino en la película de Mercedes García Guevara. ANONIMO, el malo, está esperando los comentarios del LORD y de YUPI; quizás tenga razón y se asustaron y no volvieron. Paciencia.
Otra vez aparece Marisa TOMEI, dice PEDRO que con Joe Pesci funcionó, leo creo, aunqueno me acuerdo de My cousin Vinny. Nocolas Cage, sí, MARY!
ANGELINA, "ella, como máximo, perdía un zapato", y el set ardía. Ves, dr 7? no como estos dos que andaban en pantuflas.
KOBA, que de esto sabe, le da otro voto a W. Hurt y K. Turner. Me parece que hoy me la alquilo.
Y Robert Mitchum, que tipo buen mozo.

Dice KOBA que hay que buscarles pareja a la Thompson y a Hoffman.

Hoffman con D. Winger en su versión más sexy (ella sabe cómo), por no decir Scarlette J., que le queda un poco chica.

Y a ella, Emma, es más difícil, pero cualquiera de los que estamos nombrando, más un director que le saque las pantuflas, y ya está.

AM, de tu listado de los de "sin sexo" me quedo con James Stewart y Kim Novak. ¿¿Antuco Telesca?? No me acuerdo!
La CONDESA rescata a la pareja de La Mary que tanto dio que hablar, ¿era química o era pura calentura? No es lo mismo, ¿no?
Donde, sin dudas, hay química es entre stella y Clooney, y lo confirma CANDOROSa y la misma STELLA.
GUATEMALAN GENES le pone más fichas a Ethan Hawke en Before I y Before II y habla de roces que queman: ahí hay química! Cierto que esas chispas también se veían en los novicios rebeldes, como dice LUCIA.
MONICA y ROLANDO, STELLA, vaya si tenían algo. Desde entonces, el Parque Lezama tiene una cierta connotación sexual. Epa, como te acordás de la letra. Yo me acueerdo del ROLAAAAANDO, MOOOONICA y la música en cámara lenta y va el abrazo...

ME VOY A TRABAJAR, VUELVO MÁS TARDE.

Estrella dijo...

ENTER, Kate Winslet y Di Caprio: sí, totalmente. Y Demi Moore en Propuesta Indecente: más que ¡sí!

JULI,
Y Madelaine Stowe es una de las mujeres más sensuales, aunque no tan conocida. A mí me gusta mucho.

Mickey dijo...

Madeleine Stowe trasmite una combinación rara y mortal: languidez y sensualidad.

Wonder dijo...

Estre, en mi primer comentario, le puse una pareja a la Naomi Watts.
- Vigo Mortensen y Naomi Watts en Eastern Promises
En esa peli, hay una escena muy erótica donde no pasa "nada". Viene Vigo manejando la limuosine y la estaciona lennnntamente (primer plano del paragolpe) a unos milímetros de la moto estacionada de Naomi.
Me gusta decir que en esa toma, una limousine le está haciendo el amor a una moto.

Agrego otra pareja hot:
Mensajero y yo!!!!! Ajajajajajaj!!!

lucia dijo...

Para mi Tom Hanks y Gwyneth Paltrow
no tienen química con nadie...

Yupi dijo...

No quise asomarme a este post para evitarme disgustos pero me ganó la costumbre. Mi voto:

Internacional:
1. King Kong y Jessica Lange
2. Frank Sinatra y Ava Gardner
3. Audrey Hepburn y Gregory Peck

Nacional:
1. Susana y Monzón
2. Imanol Arias y Susú Pecoraro (notable acierto del que lo recordó)
3. Wonder y Anónimo malo

Wonder dijo...

Yupi, cuando estoy con el anónimo malo nos prendemos fuego.
Lo que pasa es que ambos somos de madera.

Pía dijo...

Gary Oldman y Wynona Ryder en Drácula!!!!!!!!!! Mi fondo de pantalla!!!!!!!

Pía dijo...

Emma Thompson y Jonathan Pryce en Carrington.

Carlos G. dijo...

Uh! llegué tardísimo; algún aporte a las apuradas:
Ingrid Bergman y Charles Boyer en Arco de Triunfo
Emma Thompson y Anthony Hopkins en Lo que queda del día
Geena Davis y Brad Pitt en Thelma y Louise
Kim Basinger y Mickey Rourke en 9 semanas y media
María Schneider y Jack Nicholson en El pasajero
Winona Ryder y Gary Oldman en Drácula
Ali Macgraw y Steve McQueen en La fuga

Bueno qué se yo, hay más...

Mensajero dijo...

Wonder, pero qué honor....¿tenemos competencia?

Estrella dijo...

MICKEY, languidez y sensualidad, por eso es una mujer muy sexy.
WONDER, a VIGO le falta algo, no sabría decir qué. Quizás lo traiciona la voz. MENSAJERO y WONDER, o MENSAJERO y ANÓNIMO MALO, vos elegís!
LUCÍA, ja, Tom Hanks: porque se quedó pegado a Fortest, y Gwyneth a mí me gusta, habrá que encontrarle un ÉL.
YUPI, ¿de qué disgustos hablamos? ¡por favor! King Kong viene levantando en el ranking. Y en lo Nacional, parece que Susana y Monzón han dejado su huella, por no decir huellón.
PÍA y CARLOS apuestan por Drácula y Wynona, pero Pía, a Emma en su papel de Carrington la mataron con ese peinado!

Mientras, CARLOS G. hace las valinas y empieza la cuenta regresiva...

Mary Poppins dijo...

paz vega en "Lucia y el sexo"

maribel verdu en "Y tu mama tambien"

Estrella dijo...

MARY,

Deciddidamente SÍ. Las dos.

Estrella dijo...

En el comentario a CARLOS quise decir valijas, no valinas.

Qué cosa, qué mal tecleo, es que voy a mil por hora, y como ya les dije una vez, se me enciman los dedos. Ahora, por ejemplo, estoy escribiendo muuuuuy despacio, a ver si así puedo evitar los desastres: tac tac tac tac tac tac... en lugar de tactactactactactactctctctctct

Yupi dijo...

Querida Estrella: dentro de los tremendos disgustos que me has dado, algunos imperdonables, noto una reacción: "A Vigo le falta algo". ¡Al fin! Si a Vigo le falta, más vale ni pensar en el enteramente isósceles Di Caprio, por ejemplo. Pero no ahondemos viejas heridas. Van otras tres, empezando por la que muy bien citó Carlitos G:

1. Emma Thompson y Anthony Hopkins
2. Errol Flynn y Olivia de Havilland
3. Maia y Quintín

Mary Poppins dijo...

di caprio y Viggo me FASCINAN

Emma muy bien para que me ensenie ingles, nada mas!

Mickey dijo...

La escena que describe Wonder es tremendamente sensual.
Lo mismo que una escena de "Lo que queda del dia" (no se si acordará Gatabria), en la que Emma Thompsom le trata de sacar un libro a Hopkins.

Releyendo, el que parece que hacía lucir lo que sea a su lado es Steve McQueen (que jugaba una gran perscusión en moto en "El gran escape" Estrella!!!!!).

Wonder dijo...

Mensajero, no hay competencia. Sería afano.
Mickey! Gracias!! Por fin alguien hizo eco de mi comentario. Esa escena es terrible. Y la que contás de "Lo que queda del día también".
Cuando ella le saca el libro y él se queda petrificado, como degustándola, como devorándola (tal cual Hannibal Lecter, ja), mirándola, oliéndola, a apenas unos centímetros.
Excelente elección.

Yupi, Errol (alias el fiestero) y Olivia (alias la mojigata) estaban demasiado aceitados y compensados como pareja como para ser sexies.
Funcionaban, claro, pero no se la creía nadie.
Luego de filmar con ella, Errol salía huyendo del set a emborracharse y a corretear colegialas.

Juli dijo...

Estre, si te gusta Madeleine Stowe, como no recordar la pareja que hizo con Kevin Costner en revancha, no?

Yupi dijo...

Justamente, Wonder. Si la pareja funcionó tan extraordiariamente bien como para ser recordada casi un siglo después fue porque Errol se la quería levantar de verdad a Olivia, no estaba actuando. No hace falta decir que Olivia lo sabía y esquivaba el asalto a la ciudadela. Pero no del todo. He allí el punto crucial de la relación. Esa tensión entre puedo y no quiero y quiero y no puedo pasó a la historia por su realidad más que su ficción.

Pdta: Nótese que tanto Steve McQueen como Clint Eastwood son difíciles de asimilar a una sola pareja, hecho que confirma la tesis de Mickey.

janfi dijo...

No pude leer todos los comments, pero tiro dos que espero no estén repetidas :
1 Nacional : Carlos Monzón y Susana Gimenez en La Mary.
2 Internacional : Marlon Brando y María Schneider en ültimo Tango en París.
Avísenme si ya estaban nombradas y si no, denme mi merecido premio.

janfi dijo...

Sí, leí los comments y mensajero las había puesto.
Mensajero ¡gret minds think alike!

Estrella dijo...

YUPI, isósceles Di Caprio!
Ok, pero isoscélico y todo, el hombre tiene vibración (¡) sexual, lo que hace que el mérito sea mayor, y con esa cara de niño, además. MICKEY dio en la tecla con Steve McQueen y Clint Eastwood, pero, por ejemplo, no me gustó con M. Streep en Los Puentes de Madison.

No me acuerdo de la escena de Lo que queda del día, WONDER. Será porque no me gusta él, después de haberlo visto con las extensiones en aquella mala película con Brad Pitt.

¿Los dos hombres de Secretos en la Montaña?

Otra película malísima, la de Richar Gere y Wynona: cero química, bajo cero, diría.

sobredosisdescasez dijo...

Nada como Heath Ledger & Jake Gyllenhaal el El Secreto de la Montaña,... y que ???

janfi dijo...

Al que mencionó a Michelle Pfeiffer, le aviso que se sabe en el mundillo artístico que ella está perdidamente enamorada de mi, por lo que no toma papeles en los se juegue su amor por una tercera persona, sobre todo en despliegue físico, porque el amor platónico está permitido entre nosotros dos.

Estrella dijo...

Susana y Monzón, o más bien, La Mary y -----?

JANFI, ¿te gusta Jessica Lange?

Sí, sí, ya sabemos lo tuyo con M. Pfeiffer, para ella sos el galán de los hogares, como te bautizó ¿galois?

SOBREDOSIS, hay una escena entre ellos dos que es a-pa-sio-nan-te (cuando se reencuentran y corren uno a los brazos del otro, como Rolando y Mónica).

Yupi dijo...

Y bueno, si pensás que Birabent (¡Birabent!) me imagino tiene vibración Di Caprio ya tiene que ser una coctelera viviente. Yo sabía que no tenía que leer este post. En fin. Voy con más parejas:

1. Estrella y Bayly
2. Mary Poppins y Antonio Gala
3. Martín Karadagián y La Momia

Mary Poppins dijo...

iupii
que decepcion!!!
pense que me postulaba con usted.

Ya no me gusta mas

Estrella dijo...

Sí, Birabent tiene vibración 10, no lo dudo. Es como Madeleine S. en versión másculina. Ya lo dijo MICKEY, combinación rara de languidez y sensualidad.

Con Bayly tenemos química, cómo no: que me cuente cosas, yo lo escucho. O que me las escriba mejor, yo lo leo: ¿o acaso no hay química ahí?

Yupi y Audrey Hepburn, ya lo sabemos. O yupi y Pola, que es bien linda y le gusta Aira.

janfi dijo...

Me acuerdo de la jesica de el cartero y me gusta sí, pero convengamos que esa peli me resultó "frickeante" como cine negro, y tanto no la disfruté.

Yupi dijo...

Estrella, vamos a ver, porque me parece que esto ya pasó de castaño a oscuro, es el malentendido total. ¿A usted le parece lo mismo Audrey Hepburn que Pola? De verdad se lo pregunto. Piénselo un minuto. Le aseguro que si me contesta con una frase del tipo "cada una tiene lo suyo" acorto la agonía y me tiro por el balcón ahora mismo.

ElPoeta dijo...

Qué razón tienes, amiga.... Es crucial dar con la pareja que pueda comunicarse y comunicar a los que la ven. Un beso,
V.

Wonder dijo...

MARY POPPINS!!!!! Yo propuse tu pareja con Jupi!!!! Fijate!

JUPI, Si, lo que pasa es que Errol le apuntaba a cualquier cosa que caminara y pesara más de 20 kilos.
Por algo se murió a los 50 pero parecía un anciano de 80.
Igual, lo re banco a Errol.

ESTRE! No te acordás de esa escena? A mi tampoco me gusta ese actor, pero esa escena está buena...
Y dejate de dar vueltas. Vos hacés bellisima pareja con el Sr Sheppard

Estrella dijo...

YUPI, no, a mí no me parece, a usted le parece, porque siempre anda nombrando a la tal Audrey Hepburn. Lo de Pola es pura invención mía. Pola y yupi: sí, claro que sí. Primero hablarán de Aira, desarrollarán y desarrollarán... de ahí a la química explosiva no hay más que un paso, yupi. Usted lo sabe. Y si no, acá está Mary, reclamando un lugar en el podio.

Estrella dijo...

WONDER, ves cómo sos? Sam Sheppard, sin duda, muchas gracias.

JANFI, hubiera jurado que te gustaba Jessica Lange, para mí es una mujer sensualísima, a pesar de los años.

MARY y YUPI, qué tanto.

POETA,usted sabe del tema!

Enterhase dijo...

Tal vez John Travolta y Uma Thurman.

Sobre mi química no hablo. Soy como el carbono, y el que sepa de química sabe de lo que hablo.

Mickey dijo...

Danger!!!!!!
La conminación languidez/sensualidad en hombres da bala!

No me gusta la opera. Me aburre. (lo dije mil veces. Acá la mil una). Igual, hace unos meses me choqué con algo que me da para una recomendación.
Si quieren ver fuego, una pareja que arde: Rolando Villazón y Anna Netrebko.
El pibe es medio pescado. Ella lo tiene todo. Además de cantar, baila, es una gran actriz, es sensual, y linda. Como sea, entre los dos hay extraordinaria química.

Estrella dijo...

ENTER,
Travolta tiene química con cualquiera, lástima que Uma tenga las manos tan grandes (esto lo dijo José P. Feinmann, lo entrevisté para un programa de radio a raíz de un libro sobre cine de Hollywood que sacó ya hace un tiempo, Pasión de Celuloide, muy bueno, entre paréntesis. Uno de los cap. está dedicado a las mujeres y dice lo de las manos de Uma. Desde entonces, no puedo dejar de mirárselas, ¡y tiene razón!)

Como también tiene manos enooormes Andra Frigerio.

¿Vos, como el carbono? Acá no sabemos nada de ESA química, explicá!

MICHEY, jajaj
ok, ok, cambiemos la ecuación:

languidez + sensualidad + hombría + cara de atorrante.

Mary Poppins dijo...

que problema!

soy lo opuesto de Audrey -cualquiera lo es- soy mas del estilo Sofia Loren o bajando al mundo latino-americano Selena, la leyenda (vea en mi blog)

pero Yupi nadie me ha despreciado asi como usted Igual piense, cada una tiene lo suyo .... :)

Yupi dijo...

Qué disgusto. El único culpable soy yo, no lo niego, no culpo a nadie. Sabía que no tenía que leer el post y entré igual, así que no puedo quejarme. Entre todas las vidas posibles me imagino con Estrella después de 20 años de relación, ya con hijos crecidos, algunos grandes, ambos en el comedor de nuestra casa, yo mirándola todavía con atracción sexual, algo bastante difícil de mantener en el tiempo. Cuando de pronto oigo: "Cómo me gusta Di Caprio". Un silencio helado recorre mi cráneo. ¿Eh? ¿Habré oído bien? Naturalmente no me animo a preguntar, tal el es terror que me embarga, pero al rato el mandoble vuelve reforzado: "Qué bien escribe Bayly. Me pasaría horas leyéndolo". ¡Bayly! ¡Horas leyendo a Bayly! Ahora el silencio total. Me levanto. Me pongo las pantuflas. Salgo del cuarto.

AM dijo...

Más de cien comentarios. ¡Estrella es la Tinelli de los blogs! ¡Cómo sabe entretener a la masa!

Juli dijo...

juuuaaaa! Yupi, sus comentarios me matan. Sepalo.

lucia dijo...

Keira Knightley SOLO CON Colin Firth en Orgullo y Prejuicio.

En las demás, no.

Enterhase dijo...

Yupi es el Joyce de los comentarios.

Estre, el carbono es el elemento más liviano que puede formar múltiples enlaces covalentes. Por eso es tan importante y tiene un papel tan fundamental que cuando se habla de química orgánica se habla en realidad de química-con-carbono. Yo vendría a ser el carbono, y los enlaces mis relaciones. Los otros elementos serían Winona Ryder, Jennifer Connelly, etc.

Ramiro dijo...

En Clarín de hoy:

Identifican la hormona que interviene en los "flechazos" amorosos
06:27

Es la dopamina, una sustancia química que, en el cerebro, se relaciona con el placer y con las adicciones.

janfi dijo...

Estás dopado.

lucia dijo...

Ramiro, te conozco??

ceci dijo...

winnona con nadie!

Tom Hanks con Meg Ryan.
Richar Gere con Julia Roberts.
Andy García con Meg Ryan.

¡¡Nadie mira a una mujer como Andy!!

marmottan dijo...

el zorro y el sargento garcia

Carlos G. dijo...

Como dice Estrella estoy en cuenta regresiva: cero tiempo.
Acuerdo con Mickey en la escena de lo que queda del día.
Agrego a Jeremy Irons y Merill Streep en La amante del teniente francés.
(Merill con esa peluca enrulada y peliroja me mata)
Con los que no hay química pero son muy graciosos es con Woody Allen y Diane Keaton
Hay una peli (Baby Boom) con Diane Keaton pero no recuerdo el nombre del actor.

marmottan dijo...

Sam Sheppard y Diane Keaton en Baby Boom

Angie Angelina dijo...

Leí todo. Ahora pregunto
1) Quien es david kross?
2) quien es el sr que esta chapando con kathleen turner?
3) una pareja imperdible es gwyneth- Viggo en una peli donde ella esta casada con M douglas y ella le hace los cuernos con Viggo
4) Agrego una de Heath Ledger, con Julia Styles en 10 cosas que odio de ti, la escena donde el le canta desde la escalinata del campo de beisbol me hizo llorar, varias veces
5) CarlosG: ¡La amante del tte francés!!! Como pude olvidarla!!!
6) Hugh grant y renee zwellger en El diario de bridget jones , la 1.
7) una dificil:
Ralph Fiennes y Cate Blanchett en Oscar & Lucinda (1997)

Enterhase dijo...

Qué molesto ver cómo el periodismo (y no sólo el argentino) perpetúa la tradición de tomar los informes científicos y, so pretexto de acercarlos al lector, pisotearlos, masticarlos y escupirlos, dejándote con una pasta que no es ni ciencia ni lectura general, sino una torta de barro.

Angie Angelina dijo...

Ay, Enter, no se de que estas hablando.

Enterhase dijo...

Del comentario de Ramiro sobre la nota de Clarín.

Y agrego: además de hacer ostensión de un titular sencillamente falso, ni siquiera sabemos de dónde cazzo sacaron la "noticia". Perdón por mezclar las tres analogías en el comentario anterior.

Angie Angelina dijo...

Ahh, yo crei que hablabas de la gripe porcina, yo me agarre una simple gripe y miraba los noticieros y entre en panico!

Enterhase dijo...

Pensá en las estadísticas: por ahora, mucha más gente se muere de la gripe común. Mucha.

Angie Angelina dijo...

Sí, igual me pasé toda la tarde en un hospital porteño, muerta de frio y miedo.
¿Sos cientifico, Enter?

Enterhase dijo...

Nah, soy algo curioso nomás.

¿Les parece que compremos barbijos para la reunión?

Angie Angelina dijo...

jajajajajaj
no, lo mio son 7 dias de amoxidal nada mas

Mensajero dijo...

Wonder, seamos justos, no se olvide de Stella y Cluni....

Enterhase dijo...

O de Stella y Marlon Brando.

Steeelllaaaa!!!

Wonder dijo...

Me acabo de enterar que Cecilia Roth anda a los besos con Gonzalo Heredia.
A él no lo tenía muy visto, pero es un lindo niño.
Será q estoy mayor, pero me llaman tan poco la atención los menores...
Buen día para todos.

Angie Angelina dijo...

Bueh, la roth está separada de fito, puede hacer lo que quiera, pero la verdad
1) no me parece tan jovencito el heredia ese, aunque en gente/caras confiese 27
2) de los jovencitos, no es mi favorito, voy a usar una frase que creo que le oi a Estre, o que ella comentó: "Parece sucio".
Yo tb debo estar poniendome vieja, porque empece a pensar una alternativa y no se me ocurre ningun galan jovencito, estoy mirando pocas tiras adolescentes (igual los de la franja teen, no cuentan). En una epoca me gustaba el hno de la fonzi.

Estrella dijo...

Ja, ANGELINA, yo no dije que parecía sucio. Justamente, cuando yo digo que me gusta Birabent, una amiga se escandaliza y me contesta: ay, non parece sucio. Bueno, le digo yo, nada que no pueda arreglar una buena ducha.

Gonzalo Heeredia: lo vi en algunos cap. de Socias, ¿se acuerdan? Y sí, me parece más que buenmozo. Pero lo que no me gusta es que Sofía le sea infiel a José!

¡¡Pobre José!! No se lo merece.

¿Vieron ayer Tratame bien?

Enter, tenés razón con la nota de Clarín, siempre lo mismo, mucho ruido y pocas nueces.

No contesto a cada uno porque acá hay una gran conversación.

Gracias a todos por prenderse, así nos desconectamos un poco de lo rotundamente cotidiano, como diría Amis.

Wonder dijo...

Si, pobre José.
No para de recibir sustos.
Me dan ganas de ir a cuidarlo un rato y tratarlo bien.
Pero, aun, no tocó fondo, me parece...

Angie Angelina dijo...

claro, heredia parece sucio, como dijo tu amiga de birabent, pero ademas, ¿quien le cree que tiene 27 años? si es asi, está definitivamente arruinado.
Pero me parece que tira mas para treintapiquero.
No se, me hace acordar a cuando britney spears decia que tenia 16, pero habia sido compañera de sabrina la bruja adolescente en el disney club, que tenia en la misma epoca, 24. OH!
Mi mama siempre dice: Ah, edades de clarin. (Vieron los cumpleaños de la ultima hoja, allado del hosorcopo?)Ja!, son inverosimiles.
No me parece tan chico al lado de la roth.
Ah, Amis, que escritor duro, no entiendo como te gusta amis y no rivera, son igual de duros.

Estrella dijo...

Lo mismo pensé yo, en casa estábamos todos diciendo: pobre Joséee. Trátenlo bien.

Veremos qué se viene.

¿No te parece que te lo podés cruzar en la calle en cualquier momento?

Wonder dijo...

Estre, me lo cruzo en la calle en cualquier momento, todo el tiempo.
Vos que sos de las mías, de las que observás rostros, poses y situaciones... ¿no viste que la calle está llena de José?
Por eso gusta tanto ese programa.
Porque refleja situaciones cotidianas, más o menos adaptables, pero reales al fin.

janfi dijo...

Wonder, si no te van los jóvenes, lo nuestro es imposible; lo lamento mucho.

Wonder dijo...

Janfi, ufa.
Yo sabía que lo nuestro era imposible.
Bueno, cuando te interesen las señoras mayores como yo, avisame.

Angie Angelina dijo...

jajajaja!
Cada vez que veo un comentario de Janfi, me muero de la risa; despues en mi casa me preguntan que paso que me carcajeaba.
Me gusta por ej cuando se autodenomina el novio de michlelle pfeiffer.

Estrella dijo...

Pobre José, lo único que le faltaba, cuando se entere de que Sofía tiene una historia con Heredia. Wondeer y yo vamos a ir a consolarlo, ¿lo encontraremos en la puerta de la juguetería o habrá caído, otra vez, en brazos de la prima Norita?

Angie Angelina dijo...

el nombre Nora, no, pero Norita, en diminutivo suena a atorranta, no se, me suena a un caso policial que hubo.

Mary Poppins dijo...

ah ya veo, Yupi me deja por Pola, vale!
la Pola es guapa :(((

janfi dijo...

Angie Angelina
¿cómo "autodenomina"?
¿no lee Ud. acaso las revistas del corazón?
¿no leyó que hay un gobernador americano que tiene una novia argentina?
(es sólo para encubrir que hay un argentino de novio con Michelle)

Angie Angelina dijo...

JAJAJAJAJAJAJA!!!!!!!

Angie Angelina dijo...

che me acabo de acordar de otra escena, para que no digan que soy una puritana:
ben stiller, owen wilson y una rubia en zoolander.

Enterhase dijo...

Tiene sentido, la rubia es la esposa de Stiller!

Angie Angelina dijo...

Sí, me parecía. Creo que cuando filmaron eso era la novia todavia, no se, no me acuerdo, Ben no me lo contó. (ya que janfi tiene amigos internacionales, yo también,je)

magu dijo...

DAVID MORRISEY con otra actriz inglesa en una comedia de 2006
¿ imanol arias y susu pecoraro en Camila? ¿no?

magu dijo...

perdón que hoy vuelva, es que pensé en

Brigitte Bardot con Trintignant en Eva nació mujer de 1956 (no sé escribir el apellido de él).

Teresa Right o Wrignt con Joseph Cotten en "Bajo la sombra de la duda" de 1941 (aunque eran tío y sobrina y )

y Ésta si

FRANCK SINATRA y GRACE KELLY en ALTA SOCIEDAD (aunque ella se casa con Vin Crosby). bueno, saludos

Angie Angelina dijo...

quien es david morrisey?
¿no es el de "Sabra tu novia que escuchamos morrisey"?

magu dijo...

ANgie Angelina
DAVID MORRISEY lo descubrí el lunes viendo un flim en EUROPA EUROPA en casa de una vecina, lo dieorn a las 22 hs......hacía de pastor protestante impostor enamorado de una estafadora, comedia inglesa del año 2006. él nació el 21 de junio del 64 en LIVERPOOL y estoy recontra super enamorada de él. pero a mi marido no le molesta porque a él le gustó la que hacía de estafadora. (un chico rubio, sale en internet)

Angie Angelina dijo...

magu:
Sí, sí, lo vi.
No era Dr NO? (serie de ciencia ficcion inglesa) O por lo menos actuó ahi.
Lo que te decia era una cancion de leo garcia, muy graciosa.

Angie Angelina dijo...

quise decir Dr Who, Dr No era de james bond.

magu dijo...

ANGIE ANGELINA

Vos sabés que de DAVID MORRISEY estuve buscando lo que pude y no salió nada, solo la foto. Un churro bárbaro, pero lo poco que dice lo dice en inglés y no entiendo idiomas (aunuqe si de rostros masculinos, ja ja)...solo entendí que está casado con ESTHER FREUD, ¿será la bis nieta de Freud ?.
A LEO GARCIA no lo conozco, te lo debo.
Y dijo la Condesa sobre EWAN MC GREGOR si, con NIcole y ¿nadie tiene admiración por Keneth BRAnath (mal escrito) ...para hacer pareja con alguien,... no sé.
Bueno, esto de buscar parejas es un ejercicio muy sanador.
saludos.
julie andrews y dick van dicke ?
olivia y brutus
fiona y sdreck
el señor y la sra ingals (bueno, no me peguen)

Angie Angelina dijo...

me perdi quienes son fiona y sdreck

kenneth branagh esta bien en su versionde Frankenstein

magu dijo...

angie angelina
era en chiste, son dibujitos animados (la pareja de ogros)...pienso en trifón y sisebuta, pelopincho y cachirula, lorenzo y pepito, la pequeña lulú y tobi...y Trudy y el Marido. Es que por ahi, no, química no.

LA escena de Brigitte Bardot con no sé que actor francés, esa de EVA NACIÓ MUJER o algo asi, cuando están en una playa porque se quemó la lancha...esa es linda.

Hay una peli francesa ROMEO Y JULIETA de un actor frnncés bajito que hace de patrón de una mucama gorda cenegalesa, que también era tierna, había química pero más materno filial creo.
bueno, saludos

Y ja ja, NORA CÁRPENA con GUILLERMO BREDESTON, y jaja el matrimonio de la CAMPOY y CIBRIAN, y mejor no sigo
saludos ANGIE ANGELINA
SI

CARLOS THOMPSON con MARIA FELIX...viejísima peli

magu dijo...

prometo, prometo que es la última
ésta es explosiva

LESLIE CAROLL con MEL FERRER en LILI

Angie Angelina dijo...

maria felix es inolvidable, creo que es maria felix con el que sea.

magu dijo...

Angie Angelina
si, pero especialmente con él, parece que lo dejó mal parado.
Mi papá (padrastro) trabajaba en cine en esos años, él fue testigo de como en la vida real
Carlos Thompson dejó todo para irse con ella a México y casarse con ella, estaba locamente enamorado, y ella lo dejó por ...no me acuerdo el nombre del que hacía boleros......
bueno, feliz día también para la mentora del blog y todos.

Estrella dijo...

ANÓNIMO,
No podés ser tan cruel, qué se siente lastimando sin por qué a alguien que no conocés?
Dale, contame.
Probá, aunque sea una sola vez, hacerte amigo. Vas a ver que lo que se siente es mucho más reconfortante que la que se siente siendo despiadado y malo: malo. No puedo pensarte de otra manera, cuánto me gustaría saber qué te mueve para pasearte por los blogs escupiendo a quien sea. ¿Por qué lo hacés? Tan luego en blogs tan caseros. ¿Estás jugando?
Espero respuesta!

Angie Angelina dijo...

magu:
Agustín Lara
Estre: En estos casos, mejor ignorar, ya dije la metáfora sobre los terroristas a los que les gusta tirar una bomba solo para que slaga en los noticieros, sí ya la dije.
GFracias Estre.

magu dijo...

ANGIE ANGELINA
Si, perdoname, tarde pero.......si, era él...Agustín Lara (que me sale Magaldi aunque uno bolero, otro tango). vuelvo a la pesadilla de mirta legrand e invitados.
saludos

Minombresabeahierba dijo...

Sean Connery y Michelle Pfeiffer en "La Casa Rusia"

Jeff Bridges y Brabra Streisand en "El Espejo tiene dos caras"

Brad Bitt y Claire Forlani en "¿Conoces a Joe Black?"

Alain Delon Y Joanna Shimkus (Leticia) en "los Aventureros"

Creo que me puse demasiado romántico y nostálgico, hoy en día lluvioso...

besos

laura dijo...

como puedo conseguir ese programa o por lo menos la parte donde salía Polonio con su esposa que el decía no me digas lo mas mínimo que te digo lo ma máximo Polonio!